n a Search Results


86
Jackson Laboratory n a mouse
N A Mouse, supplied by Jackson Laboratory, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/n a mouse/product/Jackson Laboratory
Average 86 stars, based on 1 article reviews
n a mouse - by Bioz Stars, 2026-06
86/100 stars
  Buy from Supplier

86
Sangon Biotech sangon biotech n a p5 atac
Sangon Biotech N A P5 Atac, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/sangon biotech n a p5 atac/product/Sangon Biotech
Average 86 stars, based on 1 article reviews
sangon biotech n a p5 atac - by Bioz Stars, 2026-06
86/100 stars
  Buy from Supplier

86
Jackson Laboratory paper n a mouse
Paper N A Mouse, supplied by Jackson Laboratory, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/paper n a mouse/product/Jackson Laboratory
Average 86 stars, based on 1 article reviews
paper n a mouse - by Bioz Stars, 2026-06
86/100 stars
  Buy from Supplier

86
Jackson Laboratory n a
N A, supplied by Jackson Laboratory, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/n a/product/Jackson Laboratory
Average 86 stars, based on 1 article reviews
n a - by Bioz Stars, 2026-06
86/100 stars
  Buy from Supplier

86
Sangon Biotech sangon biotech n a primer
Sangon Biotech N A Primer, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/sangon biotech n a primer/product/Sangon Biotech
Average 86 stars, based on 1 article reviews
sangon biotech n a primer - by Bioz Stars, 2026-06
86/100 stars
  Buy from Supplier

86
Jackson Laboratory utrecht n a mouse
Utrecht N A Mouse, supplied by Jackson Laboratory, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/utrecht n a mouse/product/Jackson Laboratory
Average 86 stars, based on 1 article reviews
utrecht n a mouse - by Bioz Stars, 2026-06
86/100 stars
  Buy from Supplier

86
Sangon Biotech nnnnnnnnncggcatggacgagctg sangon biotech n a linker sadbc f
Nnnnnnnnncggcatggacgagctg Sangon Biotech N A Linker Sadbc F, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/nnnnnnnnncggcatggacgagctg sangon biotech n a linker sadbc f/product/Sangon Biotech
Average 86 stars, based on 1 article reviews
nnnnnnnnncggcatggacgagctg sangon biotech n a linker sadbc f - by Bioz Stars, 2026-06
86/100 stars
  Buy from Supplier

86
Wikimedia Foundation a n
A N, supplied by Wikimedia Foundation, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/a n/product/Wikimedia Foundation
Average 86 stars, based on 1 article reviews
a n - by Bioz Stars, 2026-06
86/100 stars
  Buy from Supplier

86
Sangon Biotech paper n a tn5 primera
Paper N A Tn5 Primera, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/paper n a tn5 primera/product/Sangon Biotech
Average 86 stars, based on 1 article reviews
paper n a tn5 primera - by Bioz Stars, 2026-06
86/100 stars
  Buy from Supplier

86
Azenta genewiz n a id3 cdnaseq f
Genewiz N A Id3 Cdnaseq F, supplied by Azenta, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/genewiz n a id3 cdnaseq f/product/Azenta
Average 86 stars, based on 1 article reviews
genewiz n a id3 cdnaseq f - by Bioz Stars, 2026-06
86/100 stars
  Buy from Supplier

86
Jackson Laboratory tony wyss coray58 n a human clybl 6 tf img ipsc jackson laboratory cat
Tony Wyss Coray58 N A Human Clybl 6 Tf Img Ipsc Jackson Laboratory Cat, supplied by Jackson Laboratory, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/tony wyss coray58 n a human clybl 6 tf img ipsc jackson laboratory cat/product/Jackson Laboratory
Average 86 stars, based on 1 article reviews
tony wyss coray58 n a human clybl 6 tf img ipsc jackson laboratory cat - by Bioz Stars, 2026-06
86/100 stars
  Buy from Supplier

86
Merck & Co ggccttcgtttttgataagtc merck n a primer
Ggccttcgtttttgataagtc Merck N A Primer, supplied by Merck & Co, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/ggccttcgtttttgataagtc merck n a primer/product/Merck & Co
Average 86 stars, based on 1 article reviews
ggccttcgtttttgataagtc merck n a primer - by Bioz Stars, 2026-06
86/100 stars
  Buy from Supplier

Image Search Results